10 December 2020, Volume 32 Issue 4
    

  • Select all
    |
    Overview
  • Raman Spectroscopy Measurement for Aerosol Single Particle
    CHANG Pianpian, ZHANG Yunhong
    Chinese Journal of Light Scattering. 2020, 32(4): 295-300. https://doi.org/10.13883/j.issn1004-5929.202004001
    Abstract ( ) Download PDF ( ) Knowledge map Save
    In recent years, with the rapid development of industry, the aerosol content in the atmosphere has gradually increased, resulting in frequent occurrence of haze-fog weather and increasingly severe environmental pollution. The aerosol pollution problem is mainly related to its physicochemical properties, including aerosol hygroscopicity, volatility, acidity, phase state and non-equilibrium kinetics. The research on Raman spectroscopy measurement of atmospheric aerosol single particle is summarily commented in this paper, including studying the hygroscopicity, phase transition, pH and reaction uptake coefficient of the aerosol, using optical tweezers-stimulated Raman spectroscopy to measure the volatility, non-equilibrium kinetics and phase transition, and using surface enhanced Raman spectroscopy to measure aerosol chemical composition.
    • Surface-Enhanced Raman Scattering (SERS)
  • Simulation Analysis of Surface-enhanced Raman Scattering Chip Based on the Plasma Waveguide
    LAI Chunhong, ZHOU Xiaobin, ZHU Junfeng, ZHANG Jinyu, LIU Ziqi
    Chinese Journal of Light Scattering. 2020, 32(4): 301-305. https://doi.org/10.13883/j.issn1004-5929.202004002
    Abstract ( ) Download PDF ( ) Knowledge map Save
    In this paper, a surface-enhanced Raman scattering optical fluid chip based on long-range plasma waveguide is designed. The dielectric waveguide is used to excite plasma waveguide. The coupling signal transmit through the plasma waveguide and dielectric waveguide. It may reduce the transmission loss and increase transmission distance. The excitation light of 632.8 nm is used. The gold (Au) is as a plasma waveguide core layer and PTFE is as dielectric optical waveguide core layer. The simulation results show that the dielectric optical waveguide width of 4 $\mu m$m, thickness of 0.2 um, plasma waveguide width of 4.5 $\mu m$, thickness of 13 nm, the spacing D between two waveguide of 3.1 $\mu m$, coupling effect is best. The field intensity is about 1.8024×108 and the transmission distance is about 0.3 mm which is twice of used alone the plasma waveguide transmission distance. This study provides a theoretical basis for long - range detection of surface-enhanced Raman microfluidic chip.
  • Optimization of surface enhanced Raman scattering detection conditionsfor single-stranded DNA
    JIANG Chengshun, LI Wang, LIU Yan, LU Feng
    Chinese Journal of Light Scattering. 2020, 32(4): 306-311. https://doi.org/10.13883/j.issn1004-5929.202004003
    Abstract ( ) Download PDF ( ) Knowledge map Save
    Objective:Studying the optimal detection conditions of surface-enhanced Raman Spectroscopy (SERS) for single-stranded deoxyribonucleic Acid (ssDNA).Method:ssDNA GO18(AACCTTTGGTCGGGCAAGGTAGGTT(5′~3′))is used as an example to explore the influence of different detection conditions (concentration of silver sol, laser power and integration time, sample loading method, dosage of coagulant MgSO4) on the results of SERS detection. Under the optimal detection conditions, the stability, repeatability, and detection limit were investigated, and the peak positions of the spectra were assigned.Result:The best conditions for determining ssDNA were as follows: silver sol was concentrated 100 times, laser power was 30% (60 mW), integration time was 30 s, the sample was loaded in 1.0-0.8 high-purity quartz capillary and the amount of MgSO4 (10mM) was 2.0$\mu L$. The measurement results under these conditions have high stability and good repeatability, and the detection limit is 0.625$\mu M$.Conclusion:This study optimized SERS detection conditions for ssDNA and provided a method basis for further expanding and promoting the application of SERS technology in the field.
  • SERS array toward point-of-care detection of Pseudomonas aeruginosa metabolite
    CHEN Yan, CHEN Huan, CHEN Zhoutian, LI Yingying, YANG Danting, SHEN Liliang
    Chinese Journal of Light Scattering. 2020, 32(4): 312-319. https://doi.org/10.13883/j.issn1004-5929.202004004
    Abstract ( ) Download PDF ( ) Knowledge map Save
    Pseudomonas aeruginosa which can lead to chronic clinical infection is an important pathogen of burns, urinary tract infection and cystic fibrosis. As the secondary metabolites produced by P. aeruginosa, pyocyanin (PYO) can cause cell death in patients with infection, closely related to high mortality. Therefore, the direct and rapid detection of PYO, as the biomarker of P. aeruginosa, is able to reduce the analysis time and improve the diagnostic effect. Here, we constructed a SERS array platform using silver nanoparticles modified glass slides via electrostatic adsorption to achieve the direct and rapid detection of pyocyanin in the culture medium and saliva. The results showed that, the main SERS peak shifts of PYO were mainly 420, 543, 597, 680, 1354, 1598 and 1615 cm-1. The Raman shifts at 420 cm-1 and 1615 cm-1 used for quantitative analysis were respectively attributed to -CCN ring bending and C=N ring bending, as well as C=C ring stretching and C=N ring stretching. The limit of detection of PYO in broth medium and saliva were 0.5 $\mu M$, and 0.35 $\mu M$, respectively. It is far below the detection concentration of PYO in clinical samples. This shows that the surface modified SERS array we constructed has the potential to be capable of the point-of-care detection clinically with high sensitivity of the metabolites of P. aeruginosa.
  • Preparation of Tungsten Trioxide Ultrathin Nanosheets for SERS Active Substrate and Its Performance
    SUN Zongjie, LIN Dongyue, HE Yao, SUN Yufeng, YANG Liangbao
    Chinese Journal of Light Scattering. 2020, 32(4): 320-327. https://doi.org/10.13883/j.issn1004-5929.202004005
    Abstract ( ) Download PDF ( ) Knowledge map Save
    Tungsten trioxide square nanosheets were prepared via acid-assisted one-pot process. Morphology structure and homogeneity of the materials were characterized by scanning electron microscope (SEM), transmission electron microscope (TEM) and ultraviolet-visible diffuse reflection spectrum (UV-DRS). According to the X-ray photoelectron spectroscopy (XPS) and X-ray diffraction (XRD) analysis of the elements and states in the material, the tungsten trioxide nanosheets were successfully prepared and some oxygen defects were found on the surface. Using this material as the surface-enhanced Raman scattering (SERS) substrate, different concentrations of crystal violet (CV) was detected, and the relative standard deviation (RSD) value of 917 cm-1characteristic peak was 16.13%, indicating that the substrate had high repeatability.
    • Other Optical Spectroscopic Techniques and Applications
  • SAXS Study on the Micropore Structure of Jujube
    WU Haijuan, ZHAI Hongsheng, YANG Chunming, LI Zhihong
    Chinese Journal of Light Scattering. 2020, 32(4): 328-334. https://doi.org/10.13883/j.issn1004-5929.202004006
    Abstract ( ) Download PDF ( ) Knowledge map Save
    In this paper, the microporous structures in the samples of jujube trees with different growth rings were characterized by using synchrotron radiation small angle X-ray scattering (SAXS) method. The scattered images of different tree ring samples appear in a fan shape, indicating that there are needle-like micropores in jujube tree and the preferred orientation is along the lingo fiber axis. The long axis, short axis, long axis ratio, orientation angle and orientation degree of the micropores with the growth rings were calculated. The orientation angle and orientation degree are wavy with the whole ring. From the first ring to the second ring, the pores become thinner and longer, indicating that jujube trees grow rapidly. Subsequently, the growth rings and pores become shorter and thicker, indicating that jujube trees are flourishing and need to transport more nutrients through the pores of the trunk.
    • Application in Chemistry and Biology Researches
  • Study of the Refractive Index Sensing Performances of Au Nanocuboid Particles Based on the Plasmonic Quadrupole Resonance
    LIU Jingya, ZHANG Xianzhou
    Chinese Journal of Light Scattering. 2020, 32(4): 335-342. https://doi.org/10.13883/j.issn1004-5929.202004007
    Abstract ( ) Download PDF ( ) Knowledge map Save
    The refractive index (RI) sensing performances of the single large gold nanocuboid and the large Au nanocuboid arrays were systematically studied by numerical simulation. The results show that the full width at half maximum of quadrupole resonance is much smaller than that of dipole resonance for large asymmetric Au nanoparticles. When the ends of nanoparticles become angular (quadrate ends), the quadrupole resonance wavelength will occur “red shift”, and the quadrupole resonance would possess higher sensitivity and FOM. The RI sensing properties (S≈787.72 nm /RIU, and FOM≈13.82) of Au nanocuboid arrays at quadrupole resonance are both larger than the respective parameters of single particle. The high sensitivity, large FOM and superior stability of the quadrupole resonance in large Au nanocuboid arrays would endow it with potential application in the LSPR biosensor.
  • Study on self-assembly behavior of sodium cholate by Small-angle X-ray scattering
    LI Bonan, LI Tianfu, LIU Rongdeng, WANG Zijun, LIU Yuntao, CHEN Dongfeng
    Chinese Journal of Light Scattering. 2020, 32(4): 343-347. https://doi.org/10.13883/j.issn1004-5929.202004008
    Abstract ( ) Download PDF ( ) Knowledge map Save
    Compared with conventional surfactants, sodium cholate has a special self-assembly behavior, which is due to its unique rigid steroid skeleton and amphiphilic structure. The self-assembly behavior of sodium cholate was characterized by small-angle X-ray scattering, isothermal titration calorimetry and zeta potential measurement. Aggregation driving forces of self-assembly behavior change are discussed, It was found that in the concentration range of 20mg/mL, hydrophobic interaction and hydrogen-bond interaction reached a balance. With the increase of concentration, the driving forces of hydrogen bond gradually became dominant. Through the model fitting analysis of small angle X ray scattering results, the specific shape and size information of sodium cholate was obtained, The long axis radius of sodium cholate self-assembly is between 13.5-41.2 Å, and the short axis radius is between 9.6-11.4 Å. When the concentration reaches 40 mg/mL, the self-assembly of sodium cholate reaches the maximum size.
  • Near-field Enhancement Characteristics of Gold Nanoparticles in Whole Blood Environment
    LI Junping, CHEN Na, LIU Shupeng, CHEN Zhenyi, PANG Fufei, WANG Tingyun
    Chinese Journal of Light Scattering. 2020, 32(4): 348-354. https://doi.org/10.13883/j.issn1004-5929.202004009
    Abstract ( ) Download PDF ( ) Knowledge map Save
    Localized surface plasmon resonance (LSPR) not only broadens the spectral response range of materials, but also enhances the local electric field so as to enhance the Raman signal of the molecule to be measured, playing an important role in the life sciences. In this paper, the model of single gold nanoparticle (AuNP) and double gold nanoparticles (AuNPs) in whole blood environment is established and the three-dimensional finite element method is used to systematically study effect of particle size, gap and whole blood extinction coefficient on near-field enhancement of AuNPs. The simulation results show that in single AuNP model of the whole blood environment, as the particle size increases, the plasmon resonance peak red-shifts, and the local electric field is the largest when the size is 80 nm. Compared with air medium, the AuNP resonance peak in whole blood medium red-shifts and the local electric field enhances. The effect of extinction coefficient of whole blood on local electric field was very small, and the difference of local electric field enhancement is less than 0.1 V/m. In the double AuNPs model of whole blood environment, as the gap between the two particles decreases, the plasmon resonance peak blue-shifts and the local electric field increases. When the distance between the two particles is 1 nm, the Raman enhancement factor can be as high as 1011. This study provides theoretical guidance for surface-enhanced Raman scattering (SERS) sensitivity testing of drug molecules and biomarkers in the whole blood environment.
    • Instruments and Methods
  • Experimental Research on Influence Factors of Particle Size Measurement Method based on Extinction Spectroscopy
    YANG Bin, ZHAO Rong, WANG Ji, PING Li, PAN Kewei, CAI Xiaoshu
    Chinese Journal of Light Scattering. 2020, 32(4): 355-360. https://doi.org/10.13883/j.issn1004-5929.202004010
    Abstract ( ) Download PDF ( ) Knowledge map Save
    In order to analyze the influence factors of particle size measurement method based on extinction spectroscopy, the experimental system of particle size measurement and the non-linear least square algorithm for particle size extinction spectral inversion was established. The experimental research with particle samples using three kinds of standard particles (900 nm, 2.1 $\mu m$ and 5.1 $\mu m$) was carried out under the different wave band range, wavelength selection number and particle concentration. The results show that the selection of parameters such as wavelength range, wavelength number and particle concentration has non-negligible influence on inversion accuracy of particle size of extinction spectroscopy. The SNR (signal-to-noise ratio) of extinction spectrum is the important indicator for the selection of wavelength range. There is a threshold value of wavelength selection number. When the threshold value is used, the measurement accuracy can be ensured, but also the decrease of inversion calculation speed which due to the lengthy spectral data can be avoided. The extinction value of measured particle system about 0.75 is optimized for inversion of particle size.
  • Study on fabrication of Metallic Nanodisk Arrays by hot pressing self-assembled nanospheres
    CAO yan, CHEN yihang
    Chinese Journal of Light Scattering. 2020, 32(4): 361-368. https://doi.org/10.13883/j.issn1004-5929.202004011
    Abstract ( ) Download PDF ( ) Knowledge map Save
    In this paper, self-assembled nanosphere hot stamping technology is used to spin-coat SiO2 nanosphere solution on a substrate coated with polyacrylic acid (PAA) film and polystyrene (PS) film to form a three-dimensional close-packed nanosphere structure by self-assembly. Next, a hot melt-sinking process is performed to form a periodic, hexagonal close-packed nano-bowl array on the PS film, and then the PAA film is removed using the hydrolysis characteristics of the PAA, and the PS film is turned over and moved to the silicon wafer substrate. The PS film is etched by oxygen Etching to obtain a nanohole array mask, and finally, a large-area, periodic Al nano-disk array is prepared by combining the electron beam evaporation with Al plating. At the same time, the importance of the uniformity of three-layer membrane structure to the preparation of large-area and periodic nano-disk array was also studied. The preparation of disk array based on self-assembly embossing technology is simpler, more efficient and lower cost than traditional nanometer fabrication technology. At the same time, it has potential applications in basic research of new optical elements and solar photovoltaic equipment.
    • Other Optical Spectroscopic Techniques and Applications
  • Pigment analysis of painted terracotta unearthed from the Western Han Dynasty Tomb at Lianying, Liuji in Yizheng, Jiangsu Province
    FAN Taofeng
    Chinese Journal of Light Scattering. 2020, 32(4): 369-374. https://doi.org/10.13883/j.issn1004-5929.202004012
    Abstract ( ) Download PDF ( ) Knowledge map Save
    Seventeen pieces of painted terracotta have been unearthed from the Western Han Dynasty Tomb at Lianying, Liuji in Yizheng, Jiangsu Province, during the excavation of terracotta, the remains pigment of terracotta flaked off with the mud layer. By taking samples of the mud layers with pigments, the ultra-depth-of-field microscopic observation, Raman spectroscopy and Sem energy spectrum analysis were carried out, and the results show that red pigment is cinnabar, white pigment is kaolinite and yellow pigment is realgar. Pigment purity is very high and less impurities, it can be found that the painted terracotta technology on pigment quality requirements are very high. The results provide important information for the archaeological culture of Han tombs in Jiangsu Province.
  • Raman Spectrum Analysis of Corrosion Products on the Bronze Bu in Suide Museum in Shaanxi Province
    FU Qianli, KANG Weidong, ZHANG Shangxin, HUANG Jianhua, XIA Yin
    Chinese Journal of Light Scattering. 2020, 32(4): 375-380. https://doi.org/10.13883/j.issn1004-5929.202004013
    Abstract ( ) Download PDF ( ) Knowledge map Save
    The scientific cognition of bronze rusts is an important premise and foundation for the conservation of cultural relics. In order to scientifically recognize the corrosion of a bronze Bu in the collection of Suide county museum, the corrosion of this bronze Bu was analyzed by means of laser Raman spectroscopy. The results indicated that: The composition of the rust in the bronze Bu is complex, including Clinoatacamite (Cu2 (OH) 3Cl), Atacamite (Cu2 (OH)3Cl), Malachite (Cu2CO3(OH)2), Cuprite (Cu2O) and Azurite (Cu3 (CO3) 2 (OH)2). Among them, the clinoatacamite and atacamite are harmful, which will cause further repeated corrosion of the bronze body to affect the safety of the bronze ware. These products should be urgently removed. The results were considered to be of essential importance for further restoration and conservation for the bronze Bu.
  • Mechanistic Study of Photocatalytic Overall Water Splitting on NaTaO3-based Photocatalysts by In-Situ ATR-IR Spectroscopy
    DING Qian, CHEN Tao, FENG Zhaochi, WANG Xiuli
    Chinese Journal of Light Scattering. 2020, 32(4): 381-385. https://doi.org/10.13883/j.issn1004-5929.202004014
    Abstract ( ) Download PDF ( ) Knowledge map Save
    NiO/NaTaO3:La photocatalyst was prepared by solid-state reaction and impregnation methods. We investigated the photocatalytic overall water splitting on NaTaO3-based photocatalysts by in situ ATR-IR spectroscopy. Two new species with IR absorption peaks centered at 1350 and 870 cm-1 were observed and assigned to H2O2 species. H2O2 is formed by protonation of Ta(O2), a water oxidation intermediate, when it is surrounded by a large amount of water.
  • Rapid Detection of Taxifolin by L-cysteine Functionalized Carbon Quantum Dots
    CHENG Jiawei, ZHANG Yuhui, YANG Jidong
    Chinese Journal of Light Scattering. 2020, 32(4): 386-394. https://doi.org/10.13883/j.issn1004-5929.202003015
    Abstract ( ) Download PDF ( ) Knowledge map Save
    In this paper, citric acid was used as a carbon source L-cysteine as a modifier, and carbon quantum dots with high fluorescence yield were prepared by simple hydrothermal synthesis.The experimental analsis shows that in the presence of Fe3+, the synthesized carbon quantum dots can simultaneously detect taxifolin as a fluorescent probe and a resonance Rayleigh scattering(RRS) probe. Under the optimal experimental conditions, Fe3+ can significantly quench the fluorescence of carbon quantum dots, and RRS intensity has a certain degree of enhancement. When the taxifolin was added to the above system, the fluorescence of the quenching system was recovered, and RRS spectroscopy intensity was significantly enhanced when the three coexisted. Based on this, the article optimized the detection of taxifolin by constructing two kinds of spectroscopy methods, and finally determined RRS spectroscopy method with more sensitive detection limit and wider linear range as the experimental method for rapid detection of taxifolin. Under the optimal experimental conditions, the intensity of RRS enhancement has a good linear relationship with the concentration of taxifolin in the range of 0.9-160×10-7mol/L. The minimum detection limit is 8.6×10-9mol/L, correlation coefficient is 0.9975. And the content of the standard sample detected by the experimental method is compared with the measured value of the high performance liquid chromatography indicated by the seller, and the spiked recovery experiment of the water sample has obtained satisfactory results.
Copyright © Chinese Journal of Light Scattering
Tel: 86-028-85418067　
Fax: 86-028-85418067　
E-mail: cjls@scu.edu.cn （备用：cjls@qq.com）
Powered by Beijing Magtech Co. Ltd.